rs62285217 chr3:195150676 G>A
- Sequence
gcagagcctggggagaatgaaacc[G/A]gaagcctatgccgccaccaacaag
- ASB in cell types
- HEK293 (embryonic kidney) HUVEC-C (HUVEC, umbilical vein endothelial cells) SKH1 (chronic myelogenous leukemia, BCR-ABL1 positive)
- ASB for transcription factors
- ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 2.60 | -4.44 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid