rs62288719 chr3:185354152 C>T
- Sequence
ttgactcagcctcacttcacattc[C/T]cagagctcttgatgagcctcaact
- ASB in cell types
- Peyer's patch COLO-829 (melanoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 2.38 | 0.55 | 1.00 | |||
| COLO-829 (melanoma) | 2.28 | -1.98 | 1.00 |
Items per page:
1 – 2 of 2