rs62291686 chr3:188608106 T>G
- Sequence
gattagaccaaatagatttctaca[T/G]tttcaatcagaattagctgtggcc
- ASB in cell types
- MDM(monocyte derived macrophages) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- SPI1_HUMAN TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.38 | -1.19 | 2.00 | n/a | No Hit | |||
| TAL1_HUMAN | 0.87 | 1.84 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2