rs62292672 chr3:173553958 G>T
- Sequence
atattcgcacatcaaagagaagta[G/T]tgagaaagagcaaggataagttga
- ASB in cell types
- T47D (invasive ductal carcinoma) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.62 | -0.09 | 3.56 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -1.40 | 1.40 | 1.00 |
Items per page:
1 – 2 of 2