rs62300916 chr4:76579672 C>T
- Sequence
tccctctccagtttgccttggggc[C/T]ccactgtttcctgtgatcctacac
- ASB in cell types
- breast tumor xenograft
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor xenograft | -1.35 | 1.70 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Heart_Left_Ventricle, Nerve_Tibial