rs62302024 chr4:40433821 A>C
- Sequence
tcatgcccacgcaaagtagtgaag[A/C]tgtggagtgattggcttttagtgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.49 | 0.73 | 1.03 | |||
| GM17942 (lymphoblastoid cell) | 2.06 | -2.03 | 1.00 |
Items per page:
1 – 2 of 2