rs62304800 chr4:44186647 G>A
- Sequence
actccccacgacctgcccgtctgc[G/A]tcctccccctaggggttttgagca
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.93 | -1.64 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 0.36 | 2.29 | 1.00 |
Items per page:
1 – 2 of 2