rs62305321 chr4:83533188 A>C
- Sequence
atatacaggtgtgtatatatattc[A/C]tagttacgggtgttaggacttgga
- ASB in cell types
- SU-DHL-2 (anaplastic large cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | 1.81 | 3.54 | 2.00 | 0.35 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis