rs62311817 chr4:82739400 A>G
- Sequence
gatacggtttctaacatcccctcc[A/G]gctttaaatttccagcaatttatg
- ASB in cell types
- MDA-MB-435 (amelanotic melanoma) transverse colon gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-435 (amelanotic melanoma) | -2.34 | 2.72 | 1.00 | |||
| transverse colon | -0.22 | 1.76 | 1.00 | |||
| gastroesophageal sphincter | 0.04 | 1.54 | 1.17 |
Items per page:
1 – 3 of 3