rs62328982 chr4:151801747 G>A
- Sequence
tgaggtttctgagcatcttctcag[G/A]aagatggcgctgcctcagactttc
- ASB in cell types
- WA01 (H1, human embryonic stem cells) TTC-1240 (Rhabdoid tumor of the kidney) GM12878 (female B-cells lymphoblastoid cell line) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.56 | -0.36 | 1.12 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 2.06 | -1.84 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.74 | 0.09 | 1.13 | |||
| A549 (lung carcinoma) | 1.03 | 0.56 | 1.06 | |||
| HCT-116-RAD21-mAC | 1.47 | -1.04 | 1.00 |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood