rs62332390 chr4:148445529 A>C
- Sequence
gggcaagccgaggaaggggccgag[A/C]gccgggacccctcctcctccgctc
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 2.21 | -2.17 | 1.00 | |||
| GBM39 (Human brain tumor) | -0.86 | 1.82 | 2.00 |
Items per page:
1 – 2 of 2