rs62339673 chr4:183907380 C>A
- Sequence
tctccaaaaggaacaggttccatg[C/A]gcagctctggatgggctgagtcag
- ASB in cell types
- GM23248
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 2.04 | -1.84 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Colon_Sigmoid, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic