rs6426432 chr1:4661147 G>C
- Sequence
gaactgggggctggggtgctctat[G/C]aggacttgttgaatgaaactggga
- ASB in cell types
- embryonic stem cells derived definitive endoderm
- ASB for transcription factors
- GATA6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA6_HUMAN | 0.02 | 1.74 | 1.00 | 4.85 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
