rs6510991 chr19:1021903 G>T
- Sequence
gatactatggtttttgggtttttt[G/T]gttgtttgtttgagatggattctc
- ASB in cell types
- K562 (myelogenous leukemia) neural cell
- ASB for transcription factors
- ZNF24_HUMAN NFIC_HUMAN EP400_HUMAN ILF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | 0.60 | 2.75 | 2.00 | n/a | No Hit | |||
| NFIC_HUMAN | n/a | 1.34 | 2.00 | n/a | No Hit | |||
| EP400_HUMAN | n/a | 2.23 | 2.00 | n/a | n/a | |||
| ILF3_HUMAN | -4.29 | 1.87 | 2.00 | n/a | n/a | |||
| KDM1A_HUMAN | -4.16 | 1.49 | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood