rs6554634 chr5:1186006 G>A
- Sequence
gtttgggtaagcactggctctcct[G/A]ataacctagcagtaaacacagcca
- ASB in cell types
- K562 (myelogenous leukemia) HepG2 (hepatoblastoma)
- ASB for transcription factors
- MTG16_HUMAN SOX6_HUMAN MTG8R_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG16_HUMAN | 1.41 | n/a | 4.00 | n/a | n/a | |||
| SOX6_HUMAN | 2.89 | 0.11 | 1.00 | n/a | No Hit | |||
| MTG8R_HUMAN | 1.65 | n/a | 4.00 | n/a | n/a | |||
| KDM1A_HUMAN | 1.94 | -0.43 | 1.62 | n/a | n/a | |||
| MTA2_HUMAN | 3.93 | -1.44 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 33
Motif analysis
Genetic associations
GRASP adiponectin levels, comorbid depressive syndrome and alcohol dependence, infant head circumference, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), obesity with early age of onset (age >2)
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Transverse, Esophagus_Mucosa, Liver, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood