rs6590293 chr11:128039348 A>C
- Sequence
cccctagggtgagcaaggactgta[A/C]aatacaaaacaatgaataaacaaa
- ASB in cell types
- bipolar neuron GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -2.72 | 2.97 | 1.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | -0.85 | 1.91 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP amyotrophic lateral sclerosis (als), cystatin c in serum, fasting blood glucose, ldl cholesterol change with statins, paternal transmission distortion, premature ovarian failure, total cholesterol change with statins, transmission distortion