rs6590357 chr11:128911444 T>C
- Sequence
acgccagcgctacatggagaagag[T/C]ggcaagtgcaacgtgcaccacggc
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
- ASB for transcription factors
- BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | n/a | 2.59 | 1.00 | -0.05 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
