rs6590436 chr11:130069303 G>C
- Sequence
ggcggagaggcctgggcggagcag[G/C]gcgggagaggcgcgccctgagtag
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma) MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDA-MB-231 (breast adenocarcinoma) | -0.02 | 1.12 | 2.13 | |||
| MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) | 1.21 | 0.89 | 5.00 | |||
| 22RV1 (prostate carcinoma) | -5.01 | 2.61 | 3.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic