rs6590795 chr11:100558413 C>T
- Sequence
cttcctcacttcacaaatgagtca[C/T]ctgagcaattcctttgccaagtag
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- JUN_HUMAN SSXT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | -3.27 | 2.04 | 1.33 | 2.42 | Concordant | |||
| SSXT_HUMAN | -2.66 | 2.57 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
