rs6591191 chr11:65818569 C>G
- Sequence
ggagcaaatgaaggaagcaccgct[C/G]tttcttcctgggccggcctcgctg
- ASB in cell types
- KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | 0.37 | 2.40 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood