rs6592484 chr11:72753425 C>T
- Sequence
ctagaatctcctgcctgcccccca[C/T]tggccattcaccctgtccctctgg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi) GM18486 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.21 | -0.17 | 1.08 | -2.61 | Concordant | |||
| IKZF2_HUMAN | 2.15 | -1.95 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood