rs6592965 chr7:50360284 G>A
- Sequence
ccctgccagccctggggatgagag[G/A]gaatggccgtgtctgtctgcagag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MTG8R_HUMAN TAL1_HUMAN NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTG8R_HUMAN | n/a | 1.87 | 2.00 | n/a | n/a | |||
| TAL1_HUMAN | -0.08 | 1.39 | 1.88 | 5.05 | Concordant | |||
| NFIC_HUMAN | n/a | 1.52 | 2.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
EMBL-EBI immature fraction of reticulocytes, mean corpuscular hemoglobin, mean corpuscular volume, red blood cell count
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood