rs6593210 chr7:55186493 G>A
- Sequence
cagagaggatgacttacccagcac[G/A]ttcacatcacacagctttgtggat
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- TFE3_HUMAN SP130_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TFE3_HUMAN | 2.63 | -2.42 | 1.00 | n/a | No Hit | |||
| SP130_HUMAN | 2.09 | -1.79 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), diastolic blood pressure (dbp), partial epilepsy, systolic blood pressure (sbp), triglycerides
GTEx eQTL Adipose_Visceral_Omentum, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis