rs6596197 chr5:135095473 C>A
- Sequence
gacttgtcctatggttgtttcttc[C/A]ccgcattcctaaatggaatgtgcc
- ASB in cell types
- T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | -5.40 | 1.70 | 2.67 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, ldl cholesterol change with statins, longstanding arthritis, maternal transmission distortion, mitral annular calcium, rheumatoid arthritis, tetrology of fallot, total cholesterol change with statins, transmission distortion