rs6596817 chr6:1397260 C>T
- Sequence
acaaaatgacccgttttgtggtgc[C/T]ttccaatagagacatttttaagta
- ASB in cell types
- erythroid cells testis foreskin keratinocyte GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | -5.41 | 3.23 | 2.00 | |||
| testis | 0.63 | 3.12 | 1.00 | |||
| foreskin keratinocyte | n/a | 0.74 | 2.67 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -0.37 | 0.60 | 1.17 |
Items per page:
1 – 4 of 4