rs6597327 chr6:8481924 G>A
- Sequence
ttagggattcttcttaagatctct[G/A]gagggagctctttcctcgtctagt
- ASB in cell types
- neural progenitors GM17942 (lymphoblastoid cell) PANC1 (pancreatic ductal adenocarcinoma) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.17 | 3.75 | 1.88 | 3.01 | Concordant | |||
| STAG1_HUMAN | n/a | 2.52 | 5.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), mitral annular calcium, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), triglycerides change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus