rs6598447 chr15:101300402 G>A
- Sequence
ctaaaaatgttaaacaaaataact[G/A]aataatgaaaaaattaaacaaaat
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma) KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.76 | n/a | 2.17 | |||
| A549 (lung carcinoma) | 0.59 | 0.75 | 1.01 | |||
| KMS-11 (Plasma cell myeloma) | 1.87 | -0.94 | 2.00 |
Items per page:
1 – 3 of 3