rs6598541 chr15:98727906 A>G
- Sequence
ggaaagttctccagtccctgttgc[A/G]gatctggcctgccgactcaaagta
- ASB in cell types
- Mel270 (Uveal melanoma)
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | -1.42 | 1.42 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, coronary artery disease (cad), cystatin c in serum, fasting blood glucose, hdl cholesterol, myocardial infarction (mi), serum creatinine, serum urate, years of education