rs6598860 chr1:26695193 G>A
- Sequence
agagccttgtaaggaccggctaat[G/A]agggcaggcgagtgggaaacgaat
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.09 | 0.83 | 1.99 | |||
| HCT-116 (colon carcinoma) | 1.56 | 0.20 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.82 | 0.87 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, refractive error, serum creatinine, urinary albumin-to-creatinine ratio
GTEx eQTL Esophagus_Mucosa, Esophagus_Muscularis, Minor_Salivary_Gland, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid