rs6599626 chr10:123849357 T>G
- Sequence
ataggcagtgatgaaatcattatt[T/G]ctacttcctgctgcctctcctcct
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | n/a | 1.52 | 2.50 | -2.97 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
