rs6599985 chr15:20411372 A>C
- Sequence
gaatcccctgaaacaagttttcat[A/C]tcagcacttaagtcattctttaaa
- ASB in cell types
- LUHMES-derived neurons HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES-derived neurons | n/a | 2.55 | 2.00 | |||
| HeLa S3 (cervical adenocarcinoma) | -2.06 | 2.84 | 2.00 |
Items per page:
1 – 2 of 2