rs6600436 chr1:38003828 T>C
- Sequence
ggatggtgacatgggggtggtcag[T/C]ttttaagggcaggggaacaggaga
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | -2.24 | 2.60 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, total cholesterol change with statins, transmission distortion, triglycerides change with statins