rs6602136 chr10:16612428 C>T
- Sequence
caagattctgcctggaggaaggtg[C/T]aaactctttttgctctgtccatgg
- ASB in cell types
- Jurkat (T-cells) HL-60 (acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Jurkat (T-cells) | 1.58 | -1.41 | 1.00 | |||
| HL-60 (acute myeloid leukemia) | n/a | 1.75 | 2.00 |
Items per page:
1 – 2 of 2