rs6602820 chr10:6554280 G>A
- Sequence
cgttgcagaaggaactgcaactcc[G/A]aagagagagaactctccagcagta
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -0.18 | 1.68 | 1.25 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, longstanding arthritis, rheumatoid arthritis, rheumatoid arthritis, combined control dataset, gender differentiated