rs6604026 chr1:92838046 T>C
- Sequence
ttgatcactgggtctgcgtgatgt[T/C]gtagaaatgaggggagccatgttt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.30 | -4.22 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, bipolar disorder, bipolar disorder and schizophrenia, cystatin c in serum, height, longstanding arthritis, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), multiple sclerosis, partial epilepsy, schizophrenia, serum creatinine, tardive dyskinesia, years of education
PheWAS abnormal findings on radiological breast exam, abnormal findings on radiological examination intrathoracic organs, abnormal heart sounds, acquired hypothyroidism, acute cystitis, anemia nos, anisometropia, antisocial/borderline personality disorder, arthralgia/ankylosis of temporomandibular joint, asthma, bronchopneumonia and lung abscess, cachexia, cancer of larynx, cancer, suspected or other, chronic renal failure, chronic rheumatic disease of the heart valves, cystitis, cystitis and urethritis, dermatosis nos, discoid lupus erythematosus, disease of tricuspid valve, empyema and pneumothorax, epistaxis or throat hemorrhage, esophagitis, gerd and related diseases, essential hypertension, failure to thrive, gerd, gestational diabetes, glycosuria or acetonuria, gram negative septicemia, hepatic cancer, primary, hepatomegaly, hypertension, hypertensive heart and/or renal disease, hypertensive heart disease, inflammatory disease of breast, joint effusions, lack of normal physiological development, mammographic microcalcification, mental retardation, microscopic hematuria, occlusion of cerebral arteries, with cerebral infarction, other conditions of the mother complicating pregnancy, other specified osteoporosis, patellar fracture, poisoning by psychotropic agents, polycythemia vera, secondary, premenstrual tension syndromes, reflux esophagitis, retinal edema and hypertensive retinopathy, simple goiter, spondylosis with myelopathy, suicidal ideation or attempt, swelling, mass, or lump in head and neck, symptoms involving head and neck, systemic lupus erythematosus, thoracic neuritis/radiculitis, type 2 diabetic ketoacidosis, urinary tract infection, venous embolism & thrombosis, ventral hernia, viral hepatitis c
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Thyroid