rs6605332 chr3:42228774 T>G
- Sequence
actgagattgataattgcactgtg[T/G]atatgtaagggcatgtcctatttc
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | 0.89 | -0.69 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -0.45 | 1.59 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -1.02 | 1.51 | 1.00 |
Items per page:
1 – 3 of 3