rs6627266 chrX:152821244 A>G
- Sequence
tgagaccacagccctccaaggcta[A/G]atgagaccacagccctcttggggc
- ASB in cell types
- glioblastoma patient-derived cell model
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | 1.80 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Nerve_Tibial