rs6639580 chrX:6021438 T>C
- Sequence
ctccatttgcctctcaggtcctaa[T/C]gacaaagcactcatccttaatttc
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.44 | -0.49 | 1.00 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 2.20 | -4.04 | 1.50 |
Items per page:
1 – 2 of 2