rs66508963 chr3:122365682 A>G
- Sequence
aggctgagcaaattgtgtgtcaca[A/G]tcattcccaaacactcagtagagt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) breast tumor HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- MTA2_HUMAN COT1_HUMAN BATF_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MTA2_HUMAN | -2.20 | 2.20 | 1.00 | n/a | n/a | |||
| COT1_HUMAN | -1.92 | 1.92 | 1.00 | n/a | No Hit | |||
| BATF_HUMAN | -3.29 | 3.18 | 1.00 | 3.62 | Concordant | |||
| CREB1_HUMAN | 0.15 | 1.94 | 1.00 | n/a | No Hit | |||
| JUND_HUMAN | -0.03 | 1.89 | 1.96 | n/a | No Hit |
Items per page:
1 – 5 of 13
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood