rs6656712 chr1:101323692 C>G
- Sequence
actgagcttgctggcatcctggcc[C/G]cccactggggccatttgaacactt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) iPS-derived chondrocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.95 | -0.33 | 1.50 | |||
| iPS-derived chondrocytes | 1.63 | -0.19 | 2.00 |
Items per page:
1 – 2 of 2