rs6661762 chr1:226355990 C>A
- Sequence
ggatgatccaggaggctgagttgg[C/A]tgctgccttctttcactttggcca
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
- ASB for transcription factors
- TFE2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TFE2_HUMAN | 2.63 | -4.96 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Whole_Blood