rs6661932 chr1:152924258 T>C
- Sequence
tatgtctagtaaccagtggttgtc[T/C]ggaggatgttaacctcctcacgtt
- ASB in cell types
- GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02630 (Fanconi anemi) | 1.50 | -0.44 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, infant head circumference, total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Colon_Transverse, Esophagus_Mucosa, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis