rs6663170 chr1:108152918 T>C
- Sequence
cctgagtaagtactaaagggcatt[T/C]cccaccatatgacatatagaaaga
- ASB in cell types
- macrophages form periferal blood monocyte-derived dendritic cells CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | -0.82 | 2.52 | 2.00 | |||
| monocyte-derived dendritic cells | 1.21 | 0.50 | 1.20 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.03 | 0.05 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Testis, Whole_Blood