rs6665818 chr1:175209349 G>A
- Sequence
tgattttcaagttaccactttggg[G/A]cagcagtcagtattttggcagctg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.15 | 1.49 | 1.11 | -3.42 | Concordant | |||
| STAG1_HUMAN | 1.83 | -0.07 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
