rs6666417 chr1:175155063 A>T
- Sequence
tgatctggccaccaggtggcactg[A/T]caagctggggcgacttcgttgtgg
- ASB in cell types
- WA09 (embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line) neutrophils from periferal blood GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA09 (embryonic stem cells) | 1.53 | 0.08 | 1.39 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.68 | 1.03 | 1.05 | |||
| neutrophils from periferal blood | 2.88 | 0.06 | 1.50 | |||
| GM17942 (lymphoblastoid cell) | 0.58 | -0.58 | 1.00 | |||
| hepatocytes | 1.07 | -0.02 | 1.00 |
Items per page:
1 – 5 of 5