rs6667215 chr1:223832266 C>G
- Sequence
tcaagtttacctaagaggaagaaa[C/G]agaaaattatgaaatgaacaatct
- ASB in cell types
- BEAS-2B (bronchial epithelium) CD14+ monocytes
- ASB for transcription factors
- GCR_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.25 | 1.01 | 1.38 | n/a | No Hit | |||
| STAT1_HUMAN | 2.37 | n/a | 3.00 | -0.45 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid