rs6669994 chr1:198669128 G>C
- Sequence
ttgaaatagtacccaaaactagca[G/C]attgggcaaaaattacaaagaaat
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma) JB6 (Human anaplastic large cell lymphoma)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 0.23 | 0.91 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1