rs6670186 chr1:212491501 A>T
- Sequence
cttatccttcccctctacatacac[A/T]gattggaatggggaggtgagccca
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood macrophages form periferal blood HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | n/a | 2.70 | 2.75 | |||
| monocyte-derived macrophages from peripheral blood | n/a | 3.09 | 4.00 | |||
| macrophages form periferal blood | -0.16 | 1.63 | 2.00 | |||
| HepG2 (hepatoblastoma) | 2.56 | -0.32 | 1.00 |
Items per page:
1 – 4 of 4