rs6672758 chr1:230167766 C>T
- Sequence
cagggctgcagcctggccggctga[C/T]gaggctgcctcctgctggcctccc
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia) GM02610 (Lymphoblastoid Cell Lines) IMR-5 (Neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | -0.91 | 1.18 | 1.17 | |||
| K562 (myelogenous leukemia) | 0.13 | 0.94 | 3.01 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 0.62 | -0.52 | 1.00 | |||
| IMR-5 (Neuroblastoma) | 2.01 | 0.12 | 1.00 |
Items per page:
1 – 4 of 4