rs6672880 chr1:230167938 C>A
- Sequence
tgcaattgatttttacataaatca[C/A]atgggaaataattttctaaaatac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -0.11 | 1.21 | 1.11 | |||
| GM02630 (Fanconi anemi) | 1.93 | -1.33 | 1.00 |
Items per page:
1 – 2 of 2